Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 31216
End position: 31251
Length: 36

DNA sequence
>NC_013895, from 31216 to 31251 (36 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CGCACCGTTTGTCGCACTGCTTGTCGCACCGTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 29681-31591	Sequence	HMPREF0868_0060 - putative neutral endopeptidase