Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 975383
End position: 975418
Length: 36

DNA sequence
>NC_013895, from 975383 to 975418 (36 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CCTGAAACAGGTTCTGAAACAGGTTCTGAAACAGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 974645-975973	Sequence	HMPREF0868_0809 - extracellular solute-binding protein (Protein is coded in complementary strand; from 975973 to 974645)