Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1228100
End position: 1228138
Length: 39

DNA sequence
>NC_013895, from 1228100 to 1228138 (39 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 TAGCTGTGTAATCTAGCTGTGTAATGTCGATGTGTAATC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1227790-1229091	Sequence	HMPREF0868_0582 - hypothetical protein (Protein is coded in complementary strand; from 1229091 to 1227790)