Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 523397
End position: 523435
Length: 39

DNA sequence
>NC_013895, from 523397 to 523435 (39 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 TGAACTAGCCGTCTGACCTAGCCGTCTGAACCAGCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 523362-524426	Sequence	HMPREF0868_1227 - RluA family pseudouridine synthase (Protein is coded in complementary strand; from 524426 to 523362)