Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1090591
End position: 1090630
Length: 40

DNA sequence
>NC_013895, from 1090591 to 1090630 (40 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CCACAAGCTGCAATAAGCTGTAACAAGCTGCAACATGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1090108-1091505	Sequence	HMPREF0868_0702 - aminopeptidase I zinc metalloprotease (M18)