Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 812217
End position: 812256
Length: 40

DNA sequence
>NC_013895, from 812217 to 812256 (40 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 GACTTATTTGAACTCATTTGAACTTATTTGGACTCATTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 811272-813341	Sequence	HMPREF0868_0951 - LPXTG-motif cell wall anchor domain-containing protein