Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1335919
End position: 1335960
Length: 42

DNA sequence
>NC_013895, from 1335919 to 1335960 (42 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 AAGGGTTGAATTTTAATGGGTGAATTTTAAGTGTTGAATTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1335433-1337478	Sequence	HMPREF0868_0477 - putative acyltransferase (Protein is coded in complementary strand; from 1337478 to 1335433)