Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 238073
End position: 238114
Length: 42

DNA sequence
>NC_013895, from 238073 to 238114 (42 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 TCCAAACTTCAACTTCCAAAATTCGACTTCCAAACTTCAAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 237377-238441	Sequence	HMPREF0868_1493 gap type I glyceraldehyde-3-phosphate dehydrogenase