Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 453713
End position: 453754
Length: 42

DNA sequence
>NC_013895, from 453713 to 453754 (42 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 AGCAAATGTTCCTCAGTAAATGTTCCTCAGTAAATATTCCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 452876-453943	Sequence	HMPREF0868_1298 - putative 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase