Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 575516
End position: 575557
Length: 42

DNA sequence
>NC_013895, from 575516 to 575557 (42 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 GAACCATGAAGTACGAACCACGAAGTACGAACCGCGAAGTAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 575303-576010	Sequence	HMPREF0868_1180 - putative glycerol uptake facilitator (Protein is coded in complementary strand; from 576010 to 575303)