Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1172147
End position: 1172191
Length: 45

DNA sequence
>NC_013895, from 1172147 to 1172191 (45 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 ATACAGCCGAGCCAAATACGGCCGAGCCAAATACGGCCGAGCCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1169645-1173124	Sequence	HMPREF0868_0628 - putative stage III sporulation protein E (Protein is coded in complementary strand; from 1173124 to 1169645)