Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1502880
End position: 1502924
Length: 45

DNA sequence
>NC_013895, from 1502880 to 1502924 (45 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 TCGAACTACTACTCGTCGAACCGCTATTCGTCGAACTGCTATCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1497267-1504622	Sequence	HMPREF0868_0334 - hypothetical protein (Protein is coded in complementary strand; from 1504622 to 1497267)