Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1568134
End position: 1568178
Length: 45

DNA sequence
>NC_013895, from 1568134 to 1568178 (45 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 GAAACCTGTTCAAGCGAAACCTGGTCAGGCGAAACTTGGTCAAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1566614-1568740	Sequence	HMPREF0868_0290 - hypothetical protein (Protein is coded in complementary strand; from 1568740 to 1566614)