Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 165615
End position: 165659
Length: 45

DNA sequence
>NC_013895, from 165615 to 165659 (45 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 TGAAACAAGTGCTTATGAAACAAGTGCTTATGAAACAAGTGCTTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 165142-166242	Sequence	HMPREF0868_1583 - glycosyltransferase group 2 family protein (Protein is coded in complementary strand; from 166242 to 165142)