Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 403524
End position: 403568
Length: 45

DNA sequence
>NC_013895, from 403524 to 403568 (45 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 ACACTGCGGAACCGAACACTGCGCAACCGAACACTGCGGAACCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 403417-405333	Sequence	HMPREF0868_1345 - LysM domain-containing protein