Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 707202
End position: 707246
Length: 45

DNA sequence
>NC_013895, from 707202 to 707246 (45 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 GATGTGGATGCGGCCGATGTGGATGCAGCCGATGTGGATGCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 706877-708331	Sequence	HMPREF0868_1050 - sodium:neurotransmitter symporter family protein