Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 251477
End position: 251524
Length: 48

DNA sequence
>NC_013895, from 251477 to 251524 (48 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 AAGCTTAAGCCCAAGCCCAAGCCCAAGCCCAAGCCCAAGCCTAAGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 249320-251944	Sequence	HMPREF0868_1481 ppdK pyruvate, phosphate dikinase