Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 415454
End position: 415501
Length: 48

DNA sequence
>NC_013895, from 415454 to 415501 (48 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 GGTTGATGGCCCGGTTGATGGCTCGGTTGATGGCTCGGTTGATGGCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 413999-416314	Sequence	HMPREF0868_1337 - putative GTP diphosphokinase