Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1179528
End position: 1179577
Length: 50

DNA sequence
>NC_013895, from 1179528 to 1179577 (50 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CTGTATGACACCGTATGACACCGCATGACACCGTATAACACTGTACAACA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1176397-1180374	Sequence	HMPREF0868_0621 dnaE DNA polymerase III subunit alpha (Protein is coded in complementary strand; from 1180374 to 1176397)