Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1188651
End position: 1188701
Length: 51

DNA sequence
>NC_013895, from 1188651 to 1188701 (51 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CATTAAATCCTACTGCACTTTAAATCCTACTGCACTTTAAATCCTGCTTCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1188038-1189336	Sequence	HMPREF0868_0615 - DnaD and phage-associated domain-containing protein (Protein is coded in complementary strand; from 1189336 to 1188038)