Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1742120
End position: 1742173
Length: 54

DNA sequence
>NC_013895, from 1742120 to 1742173 (54 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CTGTTCCGGCTGACCCGGCTGTTCCGGCTGTTCCGGCTGGCCCGGCTGCCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1741638-1742222	Sequence	HMPREF0868_0163 - toxin-antitoxin system, toxin component family protein (Protein is coded in complementary strand; from 1742222 to 1741638)