Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 31912
End position: 31965
Length: 54

DNA sequence
>NC_013895, from 31912 to 31965 (54 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CTGCCCAACAGCAGCAGCTTGCCCAACAACAGCAACTTGCCCAACAACAGCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 31722-32837	Sequence	HMPREF0868_0059 - hypothetical protein (Protein is coded in complementary strand; from 32837 to 31722)