Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 421335
End position: 421388
Length: 54

DNA sequence
>NC_013895, from 421335 to 421388 (54 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 GCGCAGCCAATGTCCCGGGCGCAGCCAATGCCCCGGGCGCAGCCAATGCCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 419606-422059	Sequence	HMPREF0868_1328 - putative ribonuclease J 1 (Protein is coded in complementary strand; from 422059 to 419606)