Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 8252
End position: 8308
Length: 57

DNA sequence
>NC_013895, from 8252 to 8308 (57 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CCGTTCCGGTAGATTAAGACTGTTCCGGTTGTTTAAGACTGTTTCGGTAGTTTAAGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7588-8367	Sequence	HMPREF0868_0087 soj sporulation initiation inhibitor protein Soj (Protein is coded in complementary strand; from 8367 to 7588)