Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 1517507
End position: 1517566
Length: 60

DNA sequence
>NC_013895, from 1517507 to 1517566 (60 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 ACGCATTCTGACGATGCGCATTCTTGCGATACACATTCTTTCGATGCGCATTCTGACCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1517301-1518485	Sequence	HMPREF0868_0324 - putative thermostable carboxypeptidase 1 (Protein is coded in complementary strand; from 1518485 to 1517301)