Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 523120
End position: 523179
Length: 60

DNA sequence
>NC_013895, from 523120 to 523179 (60 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 TGATGGTTCAAAGTCGGATAGTTCAAAGCCTGATGGTTCAAAGCTTGATAATTCAAAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 522545-523300	Sequence	HMPREF0868_1228 - short chain dehydrogenase/reductase family oxidoreductase