Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 216267
End position: 216329
Length: 63

DNA sequence
>NC_013895, from 216267 to 216329 (63 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 GCCAACTGAGCCAACTGAGCCAACTGAGCCAACTGAGCCAACTGAGCCAACTGAGCCAACTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 216166-216711	Sequence	HMPREF0868_1525 rplF 50S ribosomal protein L6