Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 399032
End position: 399094
Length: 63

DNA sequence
>NC_013895, from 399032 to 399094 (63 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 GCAACGGCGGCTGACTCGGTAGCAACGGCGGCTGACCCGGCAGCAACGGCGGCTGACCCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 398930-399553	Sequence	HMPREF0868_1350 - AhpC/TSA family antioxidant (Protein is coded in complementary strand; from 399553 to 398930)