Sequence retrieval

Genome: Clostridiales genomosp. BVAB3 str. UPII9-5
Start position: 949690
End position: 949752
Length: 63

DNA sequence
>NC_013895, from 949690 to 949752 (63 bp); Clostridiales genomosp. BVAB3 str. UPII9-5 CGCCGGAAAGCAAAACGCCGCCAACGGAAAGCGAAACGCCGCCGACAGAAAGCGAAACGTCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 948621-950783	Sequence	HMPREF0868_0828 - hypothetical protein (Protein is coded in complementary strand; from 950783 to 948621)