Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 2009497
End position: 2009520
Length: 24

DNA sequence
>NC_013929, from 2009497 to 2009520 (24 bp); Streptomyces scabiei 87.22 CTGTCAGCCCGTCAGCCCGTCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 2009517-2010026	Sequence	SCAB_17831 - hypothetical protein (Protein is coded in complementary strand; from 2010026 to 2009517)