Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6522512
End position: 6522535
Length: 24

DNA sequence
>NC_013929, from 6522512 to 6522535 (24 bp); Streptomyces scabiei 87.22 GGCACCTGCACCAGCACCGGCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 6521240-6522697	Sequence	SCAB_58611 - hypothetical protein (Protein is coded in complementary strand; from 6522697 to 6521240)