Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 2063642
End position: 2063668
Length: 27

DNA sequence
>NC_013929, from 2063642 to 2063668 (27 bp); Streptomyces scabiei 87.22 GTCGCCGTCGACGCCGTCCTCGCCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2063445-2064584	Sequence	SCAB_18311 - allantoicase (Protein is coded in complementary strand; from 2064584 to 2063445)