Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6278821
End position: 6278847
Length: 27

DNA sequence
>NC_013929, from 6278821 to 6278847 (27 bp); Streptomyces scabiei 87.22 CACCGGCTCCACCGGCTCCACCGGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 6278847-6279677	Sequence	SCAB_56331 - hydrolase (Protein is coded in complementary strand; from 6279677 to 6278847)