Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7122694
End position: 7122720
Length: 27

DNA sequence
>NC_013929, from 7122694 to 7122720 (27 bp); Streptomyces scabiei 87.22 CTCCGGCACCCCCGGCACCCCCGGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7122683-7123462	Sequence	SCAB_64291 - ion ABC transporter (Protein is coded in complementary strand; from 7123462 to 7122683)