Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7904456
End position: 7904482
Length: 27

DNA sequence
>NC_013929, from 7904456 to 7904482 (27 bp); Streptomyces scabiei 87.22 GACGCGGAGGACGCGGGGGACGCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7903778-7904932	Sequence	SCAB_71451 - S-adenosylmethionine--tRNA ribosyltransferase-isomerase (Protein is coded in complementary strand; from 7904932 to 7903778)