Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 7967054
End position: 7967080
Length: 27

DNA sequence
>NC_013929, from 7967054 to 7967080 (27 bp); Streptomyces scabiei 87.22 GTCTGTGGCGGCTGTGGCGGCTGTGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 7966043-7969198	Sequence	SCAB_72051 - ABC transporter (Protein is coded in complementary strand; from 7969198 to 7966043)