Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 6574898
End position: 6574933
Length: 36

DNA sequence
>NC_013929, from 6574898 to 6574933 (36 bp); Streptomyces scabiei 87.22 TTCGGGCATACGTTCGGACGTACGGTCGGTCATACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 6574263-6574931	Sequence	SCAB_59091 - hypothetical protein (Protein is coded in complementary strand; from 6574931 to 6574263)
ORF... 6574928-6576076	Sequence	SCAB_59101 - glycosyl transferase family protein (Protein is coded in complementary strand; from 6576076 to 6574928)