Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 4297781
End position: 4297840
Length: 60

DNA sequence
>NC_013929, from 4297781 to 4297840 (60 bp); Streptomyces scabiei 87.22 GTGGGGGGTGGGGCTGCGAGGGGTCGGGCTGTGGAGGGCGGGGTTGTGGAGGGCGGGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4297232-4298062	Sequence	SCAB_38201 - preprotein-processsing peptidase (Protein is coded in complementary strand; from 4298062 to 4297232)