Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 1112015
End position: 1112041
Length: 27

DNA sequence
>NC_013929, from 1112015 to 1112041 (27 bp); Streptomyces scabiei 87.22 GCGGTGTCGGCGGTGTCGGCGGTGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1111997-1113283	Sequence	SCAB_9871 cobL precorrin-6Y C5,15-methyltransferase (Protein is coded in complementary strand; from 1113283 to 1111997)