Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 1118610
End position: 1118633
Length: 24

DNA sequence
>NC_013929, from 1118610 to 1118633 (24 bp); Streptomyces scabiei 87.22 CGACGTCGTCGTCGACGCTGACGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1118276-1119136	Sequence	SCAB_9921 - hypothetical protein (Protein is coded in complementary strand; from 1119136 to 1118276)