Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 117651
End position: 117674
Length: 24

DNA sequence
>NC_013929, from 117651 to 117674 (24 bp); Streptomyces scabiei 87.22 CCGAGGGCGAGGCAGAGGCCGACG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 116778-118013	Sequence	SCAB_1071 - two component system sensor kinase (Protein is coded in complementary strand; from 118013 to 116778)