Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 1187035
End position: 1187094
Length: 60

DNA sequence
>NC_013929, from 1187035 to 1187094 (60 bp); Streptomyces scabiei 87.22 CGGCACGTCGGGCGGCACGTCGGGCGGCACGTCGGGCGGCACGTCGGGCGGCACGTCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1184615-1187089	Sequence	SCAB_10511 - hypothetical protein (Protein is coded in complementary strand; from 1187089 to 1184615)