Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 1190261
End position: 1190285
Length: 25

DNA sequence
>NC_013929, from 1190261 to 1190285 (25 bp); Streptomyces scabiei 87.22 GGCGGGGCGTGGCCGGGCCGTGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1190230-1191276	Sequence	SCAB_10561 - hypothetical protein (Protein is coded in complementary strand; from 1191276 to 1190230)