Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 1296296
End position: 1296319
Length: 24

DNA sequence
>NC_013929, from 1296296 to 1296319 (24 bp); Streptomyces scabiei 87.22 GGCGTCGGCCTCCGCGTCGGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1295487-1297631	Sequence	SCAB_11501 - hypothetical protein (Protein is coded in complementary strand; from 1297631 to 1295487)