Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 1330288
End position: 1330311
Length: 24

DNA sequence
>NC_013929, from 1330288 to 1330311 (24 bp); Streptomyces scabiei 87.22 CCCCGGCACCGGCTCCGGGCCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1330262-1330459	Sequence	SCAB_11821 - membrane anchored protein (Protein is coded in complementary strand; from 1330459 to 1330262)