Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 1361984
End position: 1362013
Length: 30

DNA sequence
>NC_013929, from 1361984 to 1362013 (30 bp); Streptomyces scabiei 87.22 GCCCCGCCACGCACCTCCCCGCCTCACCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1362008-1362730	Sequence	SCAB_12101 - gamma-butyrolactone binding protein (Protein is coded in complementary strand; from 1362730 to 1362008)