Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 1406699
End position: 1406743
Length: 45

DNA sequence
>NC_013929, from 1406699 to 1406743 (45 bp); Streptomyces scabiei 87.22 GCCGGGGACGACGGGGCCGGGGACGGCGGTGGCGGCGAGGACGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1404669-1406825	Sequence	SCAB_12471 - monooxygenase (Protein is coded in complementary strand; from 1406825 to 1404669)