Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 1448252
End position: 1448296
Length: 45

DNA sequence
>NC_013929, from 1448252 to 1448296 (45 bp); Streptomyces scabiei 87.22 CGGACGGCCCGGCCACGCAAGGACCGGCCACGGACGGCTGGGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1448236-1450290	Sequence	SCAB_12911 dxs1 1-deoxy-D-xylulose-5-phosphate synthase (Protein is coded in complementary strand; from 1450290 to 1448236)