Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 1488295
End position: 1488318
Length: 24

DNA sequence
>NC_013929, from 1488295 to 1488318 (24 bp); Streptomyces scabiei 87.22 CGGCGGCAGCGGTGGCGGTGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1487310-1488383	Sequence	SCAB_13281 - D-ribose-binding protein (Protein is coded in complementary strand; from 1488383 to 1487310)