Sequence retrieval

Genome: Streptomyces scabiei 87.22
Start position: 1564443
End position: 1564466
Length: 24

DNA sequence
>NC_013929, from 1564443 to 1564466 (24 bp); Streptomyces scabiei 87.22 TCGGCGTCGGCGGCGGCGTCGGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1564185-1564739	Sequence	SCAB_14011 - hypothetical protein (Protein is coded in complementary strand; from 1564739 to 1564185)